Residues corresponding to the hydrophobic spine M309, L320 and F401 are colored blue and rendered as sticks. with trypsin (120, trypsin:protein) for 16 hours at 37C. The resulting peptides were analyzed with a Waters nanoAcquity UPLC system (1.0100.0 mm ACQUITY C18 BEH column) coupled to a Waters QTof Premier mass spectrometer. Peptide mass spectra were…

Read More “Residues corresponding to the hydrophobic spine M309, L320 and F401 are colored blue and rendered as sticks” »

The gp41 PCR amplicon was from pNL4-3 by PCR amplification using primers with introduced XhoI and XbaI restriction sites (underlined): forward primer starting with position 7725 (XhoI) 5- gagtggtgcagagagaaactcgagcagtggg and reverse primer starting with 8722 (XbaI) 5- agctgcttgttatacttctagaaccctat. were analysed. All supernatants were concentrated 20 H-1152 dihydrochloride occasions, and two glycosylated forms (about gp33 and…

Read More “The gp41 PCR amplicon was from pNL4-3 by PCR amplification using primers with introduced XhoI and XbaI restriction sites (underlined): forward primer starting with position 7725 (XhoI) 5- gagtggtgcagagagaaactcgagcagtggg and reverse primer starting with 8722 (XbaI) 5- agctgcttgttatacttctagaaccctat” »